Global food security

Global food security

Introduction:

Global food security as determined by the balance of global food production and demand has become an important international issue in recent years. In 2008, an increase in food prices brought about a global crisis that caused political and economic instability in some developing countries. It was estimated that the demand for food will continue to increase for another 40 years due to the continuous increase in human population. The projections also indicate that an additional 70% of food production is required by 2050 to meet the needs. Currently, over one billion people are suffering from different situations of malnutrition due to lack of food supply due to plant diseases and approximately twice that population do not have access to sufficient nutrients or vitamins to meet their daily nutrition needs. Plant diseases threaten entire food crops worldwide, including citrus, banana, and grape. The situation can be attributed to the continuous decline in agricultural land area that causes a decrease in productivity. Although decrease in agricultural productivity can be attributed to a variety of reasons, damage caused by pests and pathogens plays a significant role in crop losses throughout the world. The Food and Agriculture Organization (FAO) estimates that diseases, insects, and weeds cause ~25 % of crop failure. For example, enough rice to feed the entire population of Italy is destroyed by rice blast disease every year (Dean et al. 2005).The losses in crop yield due to pathogen infections range between 20% and 40%. On average, pathogen-induced losses of maize, barley, rice and soybean are estimated to be around 12%, groundnuts and potatoes are estimated to be around 24% and wheat and cotton are estimated to be around 50% and 80%, respectively. Post-cultivation losses due to diseases and sub-standard quality are estimated to be 30%–40%. Overall, the economic losses due to infections are estimated at 40 billion dollars annually in the United States alone.

The traditional disease identification by visual assessment of plant symptoms (leaves become red or yellow and twigs stay soft) has been aided by advances in technology such as direct microscopic observation of pathogens and their manipulation in vitro. The introduction of polymerase chain reaction (PCR) by Nobel laureate Kary Mullis had a profound impact on plant disease diagnosis. While nucleic acid technology is the only choice for detecting pathogens that have not been cultured, DNA-based methods have not yet completely replaced classical microbiology and visual inspection; these three methods provide complementary information. The trend in the European Union for detecting plant pathogens, outlined in the European and Mediterranean Plant Protection Organization (EPPO) protocols, integrates phenotypic, serological, and molecular techniques. For newly discovered pathogens, it is easy to develop or adapt molecular assays within weeks of their discovery. Although nucleic acid-based techniques based on PCR and/or hybridization and biochemical assays are very sensitive, accurate, and effective for confirming visual scouting, they are unreliable as screening tests to monitor plant health status before the appearance of symptoms. They require detailed sampling procedures, expensive infrastructure, and may misrepresent the real status of infections.

These methods can be only effectively used for a restricted number of plants.

Current and future methods for plant disease detection (PDD) include proximate detection, immunological and DNA-based methods, approaches based on the analysis of volatile compounds and genes as biomarkers of disease, remote sensing (RS) technologies in combination with spectroscopy-based methodologies, and sensors based on phage display and biophotonics.

Several previous reviews address mostly biochemical and molecular methods (Hampton et al. 1990; Schaad and Frederick 2002) or applied RS techniques (West et al. 2003; Bock et al. 2010; Sankaran et al. 2010; Mahlein et al. 2012a). The present work provides information on new, alternative methods under development for effective, reliable, and early detection of pathogen infections.

Current Methods of Disease Detection:

Detection and identification of diseases in crops could be realized via both direct and indirect methods. Direct detection of diseases includes molecular and serological methods that could be used for high-throughput analysis when large numbers of samples need to be analysed. In these methods, the disease causing pathogens such as bacteria, fungi and viruses are directly detected to provide accurate identification of the disease/pathogen. On the other hand, indirect methods identify the plant diseases through various parameters such as morphological change, temperature change, transpiration rate change and volatile organic compounds released by infected plants.

Direct Detection Method

Because viruses cannot be cultivated ad hoc, serological assays were developed to detect them. More than a thousand other pathogens, bacteria, and fungi (Alarcon et al. 1990; Caruso et al. 2002) can now be detected using polyclonal and monoclonal antisera and techniques such as: enzymelinked immuneosorbent assay (ELISA). Some other pathogen detection methods are DNA based: fluorescence in situ hybridization (FISH) and the many PCR variants (PCR, nested PCR (nPCR), cooperative PCR (Co-PCR), multiplex PCR (M-PCR), real-time PCR (RT-PCR), and DNA fingerprinting). Others are RNA based: reverse transcriptasePCR, nucleic acid sequence-based amplification (NASBA), 4 F. Martinelli et al. and AmpliDet RNA. All of these methods can overcome uncertain diagnosis or pathogen taxonomy, enabling a rapid and accurate detection and quantification of pathogens (López et al. 2009). Sample preparation for molecular analysis is critical and requires reproducible and efficient protocols. Many published protocols for RNA and DNA isolation exist; all were developed to avoid the presence of inhibitory compounds that compromise detection (Louws et al. 1999). The primary compounds that inhibit DNA polymerase activity are polysaccharides, phenolic compounds, or humic substances from plants or other substrates (Minsavage et al. 1994; Mumford et al. 2006).

• PCR

The polymerase chain reaction (PCR) was originally developed in 1983 by the American biochemist Kary Mullis. He was awarded the Nobel Prize in Chemistry in 1993 for his pioneering work.

PCR is used in molecular biology to make many copies of (amplify) small sections of DNA^? or a gene^?.

Using PCR it is possible to generate thousands to millions of copies of a particular section of DNA from a very small amount of DNA.

PCR is a common tool used in medical and biological research labs. It is used in the early stages of processing DNA for sequencing^?, for detecting the presence or absence of a gene to help identify pathogens during infection, and when generating forensic DNA profiles from tiny samples of DNA.

The basic steps are:

• Denaturation(96°C):

Heat the reaction strongly to separate, or denature, the DNA strands. This provides single-stranded template for the next step.

• Annealing (55-65°C):

                   Cool the reaction so the primers can bind to their complementary sequences on the single-stranded template DNA.

• Extension(72⁰C):

                   Raise the reaction temperatures so Taq polymerase extends the primers, synthesizing new strands of DNA.

Dignosis of bacterial blight in pomegranate by using pcr techniques

Bacterial blight caused by Xanthomonas axonopodis pv. punicae is a major disease of pomegranate. Bacterial blight drastically reduces the yield and quality of fruits, which are critical for pomegranate production. Precise and early diagnosis of bacterial blight is crucial for active surveillance and effective management of the disease. symptoms based disease diagnostic methods are labor-intensive, timeconsuming and may not detect disease on asymptomatic plants. DNA-based disease diagnostics using polymerase chain reaction (PCR) are reliable, precise, accurate and quick. PCR coupled with agarose gel electrophoresis (PCR-AGE), PCR coupled with capillary electrophoresis (PCR-Ce) and real-time PCR (qPCR) were applied for the early and accurate diagnosis of bacterial blight in pomegranate. PCR-CE and qPCR were capable of diagnosing bacterial blight 6 to 10 days before symptom appearance, with detection limits of 100 fg and 10 fg of bacterial DNA respectively. However, conventional PCRAGE detected pathogen at the onset of disease symptoms with a detection limit of 10 pg of bacterial DNA. qPCR detected bacterial blight in orchards that did not show any disease symptoms. Our data demonstrate that qPCR is more sensitive than other PCR methods along with being reliable for early diagnosis.

Pomegranate is an important fruit crop of subtropical and tropical regions of the world and is promoted as a functional food and nutraceutical source with health promoting benefits. Additionally, the long shelf life of pomegranate encourages huge demand in domestic and international markets. India is the largest producer of pomegranate in the world with an annual production of 2,442 thousand tonnes grown in 209 thousand hectares. The annual pomegranate fruit export is approximately 35,000 tonnes. Bacterial blight caused by Xanthomonas axonopodis pv. punicae (Xap) is a major constraint of pomegranate cultivation and production. Bacterial blight mostly affects above ground parts of pomegranate such as leaves, twigs, and fruits. The initial water-soaked lesions appear only after 6 to 7 days of infection under favourable field conditions and develop into late necrotic blighting. Fruits exhibit isolated water-soaked lesions followed by necrosis with small cracks, leading to splitting of the entire fruit. Severe disease outbreaks can cause 60 to 80% yield losses. Bacterial blight is gaining international attention through its recent spread to other major growing areas of the world such as Pakistan, South Africa and Turkey. Xap is a gram negative, rod shaped bacterium that measures 0.4 to 0.75 × 1.0 to 3.0 μm with single polar flagellum. Xap is cultured in vitro on different synthetic media; peptone yeast extract dextrose media, nutrient glucose agar and Luria-Bertani media. Xap produces smooth, circular, light yellow, glistening mucoid, butyrous and convex colonies with entire margins. Xap genome (4.94 Mb) is >99% identical to Xanthomonas axonopodis pv. citri, encodes 4,385 protein coding genes, 50 tRNA and 3 rRNA genes. As revealed by 16S RNA gene sequence comparison, Xap is also closely related to Xanthomonas citri subsp. malvacearum and X. axonopodis pv. manihotis.

• Fluorescence in-situ Hybridization (FISH):

Another type of molecular detection technique is fluorescence in-situ hybridization (FISH), which is applied for bacterial detection in combination with microscopy and hybridization of DNA probes and target gene from plant samples. Due to the presence of pathogen-specific ribosomal RNA (rRNA) sequences in plants, recognizing this specific information by FISH can help detect the pathogen infections in plants. In addition to bacterial pathogens, FISH could also be used to detect fungi and viruses and other endosymbiotic bacteria that infect the plant. The high affinity and specificity of DNA probes provide high single-cell sensitivity in FISH, because the probe will bind to each of the ribosomes in the sample. However, the practical limit of detection lies in the range of around 103 CFU/mL. In addition to the detection of culturable microorganisms that cause the plant diseases, FISH could also be used to detect yet-to-be cultured (so called unculturable) organisms in order to investigate complex microbial communities. However, besides the advantages, FISH also has some pitfalls that compromise the technique’s potency for plant disease detection. For example, false positive results with autofluorescence materials are a common problem that often lowers the specificity. Accuracy and reliability of FISH is highly dependent on the specificity of the nucleotide probes. Insufficient penetration, higher order structure of target or probe (e.g., three-dimensional rRNA, loop and hairpin formation and rRNA-protein interactions), low rRNA content, photobleaching could also cause false negative results and hence compromise the limit of detection.

• Enzyme-linked immunosorbent assay (ELISA):

The enzyme-linked immunosorbent assay (ELISA) is another molecular method for identification of diseases based on antibodies and color change in the assay. In this method, the target epitopes (antigens) from the viruses, bacteria and fungi are made to specifically bind with antibodies conjugated to an enzyme. The detection can be visualized based on color changes resulting from the interaction between the substrate and the immobilized enzyme. The performance of ELISA can be improved greatly with the application of specific monoclonal and recombinant antibodies which are commercially available. Specific monoclonal antibodies have been used in ELISA to achieve lower limits of detection in the order of 105–106 CFU/mL. For plant disease detection, tissue print-ELISA and lateral flow devices that enable detection have been fabricated for on-site detection. However, the sensitivity for bacteria is relatively low (105–106 CFU/mL, Table 1) making it useful only for the confirmation of plant diseases after visual symptoms appear but not for early detection before disease symptoms occur.

• Flow Cytometry(FCM):

Flow cytometry (FCM) is a laser-based optical technique widely used for cell counting and sorting, biomarker detection and protein engineering. FCM is used for rapid identification of cells while cells pass through an electronic detection apparatus in a liquid stream. The advantage of this technology is the capability for simultaneous measurement of several parameters. The technique uses an incident laser beam and measures the scattering and fluorescence of the laser beam reflected from the sample. Although FCM has been primarily applied to study cell cycle kinetics and antibiotic susceptibility, to enumerate bacteria, to differentiate viable from non-viable bacteria, and to characterize bacterial DNA and fungal spores, it is still a relatively new technique for plant disease detection application.

FCM in combination with fluorescent probes has been applied for rapid detection of foodborne bacterial pathogens. Accurate detections within 30 min down to level of 104 colony forming units (CFU) per milliliter have been reported. FCM has been proven to be efficient for detection of soil borne bacteria such as Bacillus subtilis in mushroom composts. In addition to bacterial detection, FCM has also been reported for viability evaluation as well.

Detection of the Plant Pathogenic Bacterium Xanthomonas campestris pv. campestris in Seed Extracts of Brassica sp. Applying Fluorescent Antibodies and Flow Cytometry

Xanthomonas campestris pv. campestris (Xcc) is a seed-transmitted plant pathogenic bacterium that causes black rot of crucifers. Seed lots and plants are screened for contamination with this pathogen using plating or serological assays. These methods, however, are time consuming and not very sensitive, respectively. Therefore, flow cytometry (FCM) was evaluated as a tool for the rapid detection and quantification of Xcc cells labeled with a mixture of specific fluorescein isothicyanate (FITC)-monoclonal antibodies (mAb) in pure culture, in mixed cultures of Xcc with either the common saprophyte Pseudomonas fluorescens (Psf) or a nonpathogenic X. campestris isolate (Xc), and in crude seed extracts.

Methods

The mAb 18G12, conjugated with FITC, was tested at dilutions of 1:50, 1:100, 1:200, and 1:400. For mixed suspensions of Xcc and Psf, mAb 18G12 was used at a dilution of 1:100. The combination of mAbs 18G12, 2F4, and 20H6, all conjugated with FITC, was used at a dilution of 1:100 for the detection and quantification of Xcc cells in mixed suspensions containing Xcc and Xc and in crude seed extracts. The analyses were performed with a Coulter EPICS XL-MCL flow cytometer, at low flow rate during 2 min.

• Hyperspectral Techniques (HSI):

Hyperspectral imaging can be used to obtain useful information about the plant health over a wide range of spectrum between 350 and 2500 nm. Hyperspectral imaging is increasingly being used for plant phenotyping and crop disease identification in large scale agriculture. The technique is highly robust and it provides a rapid analysis of the imaging data. Furthermore, hyperspectral imaging cameras facilitate the data collection in three dimension, with X- and Y- axes for spatial and Z- for spectral, which contributes to more detailed and accurate information about plant health across a large geographic area [40]. Hyperspectral techniques have been widely used for plant disease detection by measuring the changes in reflectance resulting from the biophysical and biochemical characteristic changes upon infection. Magnaporthe grisea infection of rice, Phytophthora infestans infection of tomato and Venturia inaequalis infection of apple trees have been identified and reported using hyperspectral imaging techniques.

Hyperspectral imaging for small-scale analysis of symptoms caused by different sugar beet diseases

Hyperspectral imaging (HSI) offers high potential as a non-invasive diagnostic tool for disease detection. In this paper leaf characteristics and spectral reflectance of sugar beet leaves diseased with Cercospora leaf spot, powdery mildew and leaf rust at different development stages were connected. Light microscopy was used to describe the morphological changes in the host tissue due to pathogen colonisation. Under controlled conditions a hyperspectral imaging line scanning spectrometer (ImSpector V10E) with a spectral resolution of 2.8 nm from 400 to 1000 nm and a spatial resolution of 0.19 mm was used for continuous screening and monitoring of disease symptoms during pathogenesis. A pixel-wise mapping of spectral reflectance in the visible and near-infrared range enabled the detection and detailed description of diseased tissue on the leaf level. Leaf structure was linked to leaf spectral reflectance patterns. Depending on the interaction with the host tissue, the pathogens caused diseasespecific spectral signatures. The influence of the pathogens on leaf reflectance was a function of the developmental stage of the disease and of the subarea of the symptoms. Spectral reflectance in combination with Spectral Angle Mapper classification allowed for the differentiation of mature symptoms into zones displaying all ontogenetic stages from young to mature symptoms. Due to a pixel-wise extraction of pure spectral signatures a better understanding of changes in leaf reflectance caused by plant diseases was achieved using HSI. This technology considerably improves the sensitivity and specificity of hyperspectrometry in proximal sensing of plant diseases.

The reflectance of leaves is the result of multiple interactions between incoming irradiation and biophysical (e. g. leaf surface, tissue structure) and biochemical characteristics (e.g. content of pigments and water) of plants Several studies have described the prospects of sensing leaf reflectance in the visible (VIS, 400-700 nm), near infrared (NIR, 700-1000 nm) and short wave infrared (SWIR, 1000-2500 nm) for detecting changes in plant vitality with emphasis on fungal plant diseases using non-imaging spectroradiometers Disease symptoms result from physiological changes in plant metabolism due to activities of pathogens The

impact on physiology and phenology of plants varies with the type of host-pathogen interaction and may cause modifications in pigments, water content, and tissue functionality of plants or in the appearance of pathogen-specific fungal structure . All these factors may change the spectral characteristics of plants. Knowledge on the effects of pathogens on the metabolism and structure of plant tissue is therefore essential for hyperspectral discrimination of healthy and diseased leaf and canopy elements

Hyperspectral imaging is an innovative technology with high potential for non-invasive sensing of the physiological status of vegetation and may allow an objective and automatic assessment of the severity of plant diseases in combination with continuative data analysis methods

• NASBA:

NASBA was developed by J Compton in 1991, who defined it as “a primer-dependent technology that can be used for the continuous amplification of nucleic acids in a single mixture at one temperature. Immediately after the invention of NASBA it was used for the rapid diagnosis and quantification of HIV-1 in patient sera. Although RNA can also be amplified by PCR using a reverse transcriptase (in order to synthesize a complementary DNA strand as a template), NASBA’s main advantage is that it works at isothermic conditions – usually at a constant temperature of 41 °C. NASBA can be used in medical diagnostics as an alternative to PCR that is quicker and more sensitive in some circumstances.

Real-time NASBA for detection of Strawberry vein banding virus

Strawberry vein banding virus (SVBV) is a viral pathogen infecting Fragaria species. It belongs to the genus Caulimovirus (retroid viruses), having a double stranded circular DNA genome. SVBV is transmitted by grafting or by aphids in a semi-persistent manner (Frazier and Converse, 1980) and its presence in strawberry plants has been reported from many countries worldwide (Frazier and Morris, 1987; Converse, 1992;Honetˇslegrov´aetal.,1995;Petrziketal.,1998a). Symptoms of SVBV in field strawberries are usually not pronounced thereby escaping visual selection.

Materials and methods

Virus isolates

The SVBV isolates (9010, 9044 and 9093) used in this study were obtained from the National Clonal Germplasm Repository, Corvallis, Oregon USA. They represent the American western-type isolates. The isolates were maintained on Fragaria vesca var. Alpine and Fragaria ananassa var. UC4 and UC6. Evaluation of the method was done on 317 strawberry field plants (F. ananassa) originating from the Czech Republic, Slovak Republic, Poland, Latvia and Italy. Strawberry Crinkle Virus (SCV) and Strawberry Mottle Virus (SMoV) isolates originated from the Czech Republic. They were maintained on F. ananassa var. UC4 and var. Cacanska rana, respectively. Alpine plants raised from seeds were used as healthy control. All plants were maintained in an insect proof air-conditioned greenhouse.

Isolation of nucleic acids

Homogenisation of strawberry leaves was done by means of the Bioreba (Reinach, Switzerland) Extraction bags and the Bioreba HOMEX 6 homogeniser in the sample extraction buffer (0.14M NaCl, 2mM KCl, 2mM KH2PO4, 8mM Na2HPO4.2H20 (pH 7.4), 0.05% v/v Tween-20, 2% w/v polyvinylpyrrolidone 40, 0.2% w/v ovalbumin, 0.5% w/v bovine serum albumin, w/v 0.05% sodium azide) added in a ratio 1:10 (w:v). Hundred microlitre of this solution was used for extraction of nucleic acids by the RNeasy Plant Mini Kit or Dneasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany). RNA was eluted in 100µl of RNase free water and stored at −60◦C. DNA was eluted in 200µl of low salt DNeasy dilution buffer and stored at−20◦C.

Synthesis of in vitro RNA

PrimersRP(5TTTCTCCATGTAGGCTTTGA3) and T7FP (5 aat tct aat acg act cac tat agg gag AGT AAG ACT GTT GGT AAT GCC A 3– lower case letters indicate the T7 RNA polymerase promoter sequenceoverhang)wereusedtoamplifya435bplong region within the capsid protein (CP) gene. The template was a full-length clone of an American SVBV isolateinpUCplasmiddesignatedpSVBV-E3(Stenger et al., 1988), obtained from the American type culture collection (product No. 45058, Rockville, MD). DNA of the full-length clone was added to a 100µl reaction mixture containing 1×Taq-buffer, 4mM MgCl2, 100nMdNTPeach, 100nMprimersand1UAmpliTaq Gold polymerase. The amplification mix was preheated for 10min at 94◦C, followed by 40 cycles of 15s at 94 ◦C, 30s at 60◦C and 60s at 72◦C. The PCR product generated was purified from low melting agarose and transcribed for 3h at 37◦C. The reaction mixture consisted of 1× T7 RNA polymerase transcription buffer, 1mM rNTP each, 100mM DTT, 20U RNA guard and 100U T7 RNA polymerase. The synthesised RNA was purified by the RNeasy Mini Kit (Qiagen) and its amount was determined by using a Beckman spectrophotometre. The serial dilutions of in vitro RNA in NASBA water (Bio Merieux BV, Boxtel, the Netherlands) were prepared reshly froman aliquoted stock solution stored at−60◦C prior to each NASBA experiment.

Amplification of RNA by NASBA allows direct detection of viable cells of Ralstonia solanacearum in potato

Develop a Nucleic Acid Sequence Based Amplification (NASBA) assay, targeting 16S rRNA sequences, for direct detection of viable cells of Ralstonia solanacearum, the causal organism of bacterial wilt. The presence of intact 16S rRNA is considered to be a useful indicator for viability, as a rapid degradation of this target molecule is found upon cell death.

Methods

RNase treatment of extracted nucleic acids from R. solanacearum cell suspensions that NASBA exclusively detected RNA and not DNA. viable and chlorine-killed cells of R. solanacearum were added to a potato tuber extract and tested in NASBA and PCR. In NASBA, only extracts spiked with viable cells resulted in a specific signal after Northern blot analysis, whereas in PCR, targeting 16S rDNA sequences, both extracts with viable and killed cells resulted in specific signals. The survival of R. solanacearum on metal strips was studied using NASBA, PCRamplification and dilution plating on the semiselective medium SMSA. A positive correlation was found between NASBA and dilution plating detecting culturable cells, whereas PCRamplification resulted in positive reactions also long after cells were dead. The detection level of NASBA for R. solanacearum added to potato tuber extracts was determined at 104 cfu per ml of extract, equivalent to 100 cfu per reaction. With purified RNA a detection level of 104 rRNA molecules was found. This corresponds with less than one bacterial cell, assuming that a metabolically active cell contains ca 105 copies of rRNA. Preliminary experiments demonstrated the potential of NASBA to detect R. solanacearum in naturally infected potato tuber extracts.

• DNA Sequencer:

DNA sequencing is the process of determining the nucleic acid sequence – the order of nucleotides in DNA. It includes any method or technology that is used to determine the order of the four bases: adenine, guanine, cytosine, and thymine. The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery.

DNA Sequencer Method Of detection of Wheat Disease

As wheat is one of the world’s most important crops, a group of scientists wanted to develop a new method for analyzing pathogen DNA in wheat leaf samples. Using a portable DNA sequencer, they were able to achieve early-stage and broad-range detection of pathogens in wheat — and they were also able to characterize all organisms in the wheat and confirmed the presence of an unexpected diseases not previously diagnosed by pathologists.

As wheat is one of the world’s most important crops, a group of Australia-based scientists wanted to address this limitation by developing a new method for analyzing pathogen DNA in wheat leaf samples. Using a portable DNA sequencer, they were able to achieve early-stage and broad-range detection of pathogens in wheat — and they were also able to characterize all organisms in the wheat and confirmed the presence of an unexpected diseases not previously diagnosed by pathologists.

According to the scientists behind this research, “A combination of on-site and centralized sequencing approaches would, in future, revolutionize management of agricultural biosecurity and reduce crop loss.” Additionally, these methods can be incorporated into routine field diseases monitoring and biosecurity monitoring at national borders to save time and money and prevent another devastating outbreak like the one seen in Bangladesh.

This research, discussed in the open access article “Pathogen Detection and Microbiome Analysis of Infected Wheat Using a Portable DNA Sequencer,” also explores the way this new strategy can identify diseases-inhibiting microbes for use in environmentally friendly control of diseases.

• Image Processing Technique:

The present work proposes a methodology for detecting plant diseases early and accurately, using diverse image processing techniques and artificial neural network (ANN). And the Image processing is the use of computer algorithms to perform image processing on  images.

Relying on pure naked eye observation to detect and classify diseases can be expensive various plant diseases pose a great threat to the agricultural sector by reducing the life of the plants. The present work is aimed to develop a simple disease detection system for plant diseases. The work begins with capturing the images. Filtered and segmented using Gabor filter. Then, texture and colour features are extracted from the result of segmentation and Artificial neural network (ANN) is then trained by choosing the feature values that could distinguish the healthy and diseased samples appropriately.

Working:

The work commence with capturing images using cameras or scanners. These images are made to undergo pre-processing steps like filtering and segmentation. Then different texture and colour features are extracted from the processed image. Finally, the feature values are fed as input to the ANN classifier to classify the given image.

• Input Image:

The first step is to capture the sample from the digital camera and extract the features. The sample is captured from the digital camera and the features are then stored in the database.

• Image Database:

The step is creation of the image database with all the images that would be used for training and testing. The construction of an image database is clearly dependent on the application. The image database consists of some image samples. The image database is responsible for the better efficiency of the classifier as it is that which decides the robustness of the algorithm.

• Image Pre-processing:

Image pre-processing, whose aim is an improvement of the image data that suppress undesired distortions or enhances some image features important for further processing and analysis task. It does not increase image information content. Its methods use the considerable redundancy in images. Neighbouring pixels corresponding to one real object have the same or similar brightness value. If a distorted pixel can be picked out from the image, it can be restored as an average value of neighbouring pixels .In the proposed approach image pre-processing methods are applied to the captured image which are stored in image database.

• Feature Extraction:

The aim of this phase is to find and extract features that can be used to determine the meaning of a given sample. In image processing, image features usually include colour, shape and texture features.

• Gabor filter

A set of features are computed from the response of the image samples to the Gabor filters. They are unichannel features given by

Chili Disease Detection Using Image Processing Techniques

Producing chili is a daunting task as the plant is exposed to the attacks from various micro-organisms and bacterial diseases and pests. The symptoms of the attacks are usually distinguished through the leaves, stems or fruit inspection. This paper discusses the effective way used in performing early detection of chili disease through leaf features inspection.

Chili is included in the main horticultural commodities. At certain times, it becomes a very high demand in the market because supply is limited. Business chili indeed belongs in the high-risk plants. Therefore, strategies and technical knowledge and the field became an important matter to be mastered. The systematic and structured should be developing so that it will use by operators to increase the overall production. Many farmers refused to cultivate chili in the rainy season due to the increase of chili disease to become high risk for the quality control and productivity. Fig. 1 illustrates the samples of plant chili disease.     In general, there are two types of factors which can bring death and destruction to chili plants; living (biotic) and nonliving (a biotic) agents. Living agent’s including

insects, bacteria, fungi and viruses. Nonliving agents include extremes of temperature, excess moisture, poor light, insufficient nutrients, and poor soil pH and air pollutants. Diseased plants can exhibit a variety of symptoms and making diagnosis was extremely difficult. Common symptoms are includes abnormal leaf growth, color distortion, stunted growth, shriveled and damaged pods. Although pests & diseases can cause considerable yield losses or bring death to the plants and it’s also was directly affect to human health. However, crop losses can be minimized, and specific treatments can be tailored to combat specific pathogens if plant diseases are correctly diagnosed and identified early. These need-based treatments also translate to economic and environmental gains.

• RAPD (Random Amplification of Polymorphic DNA):

It is a type of PCR, but the segments of DNA that are amplified are random. The scientist performing RAPD creates several arbitrary, short primers, then proceeds with the PCR using a large template of genomic DNA, hoping that fragments will amplify.

RAPD technique is a simple, rapid, requires a small quantity of template DNA and involves no radioactivity. This technique have been used in conjunction with bulked segregant analysis which involves screening of two pooled DNA samples of individuals originating from a single cross. The two resultant bulked DNA samples differ genetically only in the selected region and are seeminly heterozygous and monomorphic for all other regions.

RAPD analysis of Colletotrichum species causing chilli anthracnose disease

Chilli (Capsicum annuum L.) is an important tropical and subtropical crop on the basis of its high consumption, nutritional and cash value to farmers and consumers both in developed and developing countries, particularly in Thailand. Anthracnose of chilli is one of the most destructive diseases of chilligrowing areas in Thailand (Oanh et al., 2004; Taylor, 2007) and also in the tropical Asia (Sariah, 1989; Shin et al., 2000; Sharma et al., 2005). Anthracnose disease has been reported to be caused by several Colletotrichum species: C. capsici, C. acutatum, C. gloeosporioides, C. coccodes and C. dematium (Hong and Hwang, 1998; Gopinath et al., 2006). Those species of Colletotrichum, C. gloeosporioides (Penz.) Penz. & Sacc. and C. capsici (Syd.) E. J. Butler & Bisby are the most frequently cited as causal agents of chilli anthracnose. Mannandhar et al. (1995) reported that C. gloeosporioides strains causing anthracnose disease on chilli fruits in Taiwan. Moreover, Gopinath     et al. (2006) found that anthracnose of chilli caused by C. capsici which has been become a serious problem for chilli cultivation in India. The fungus is distributed throughout the tropics and very commonly occurs in chilli growing areas. C. capsici appeared to be the most severe being able to infect a range of Capsicum species and resistant genotypes (Taylor, 2007). The disease produces symptoms on leaves, stem and fruits.

Materials and methods

Isolation and identification of the pathogens from infected chilli

The pathogens were isolated from the symptoms on three varieties of chilli as follows: Chilli pepper (Capsicum annuum), Long cayenne pepper (C. annuum var acuminatum) and Bird’s eye chilli (C. frutescens). The disease samples of leaves and fruits were collected in the fields in Ratchaburi province, Thailand, then kept in moisten chamber and brought to laboratory. Isolation of causing agent was done by using tissue transplanting technique. The disease plant parts were cut at the advanced margin of lesions in to small pieces (5 mm × 5 mm) and then surface were disinfected with 10% Clorox for 1 min, followed by washing in sterile distilled water, and transferred onto isolating medium (water agar, WA). The mycelia growing out of the plant tissue were sub-cultured to potato dextrose agar (PDA) medium, and incubated at room temperature for 7-10 days (approximately 28-30°C). Single spore isolation was also done to be pure culture. The isolate was identified into species by observation of morphology under compound microscope.

Genomic DNA isolation and PCR amplification of DNA

The total genomic DNA of Colletotrichum sp. was isolated from mycelia. Isolates were incubated at 28oC for 4 days in tubes containing 20 ml of potato dextrose broth, agitated at 180 rpm. Mycelia were harvested by filtration through filter paper, dried between two layers of filter paper and stored at 80oC for further use. Dried mycelium was ground to fine powder with pestle and mortar using liquid nitrogen and transferred to 1.5 ml Eppendorf tube. 600 µl Cetyltrimethylammonium bromide (CTAB) was added and incubated at 65oC for 30 min, tubes were vortexed every 10 min. After cooling at room temperature equal volume (600 µl) of chloroform:isoamyl alcohol (24:1, v/v) was added in fume hood cabinet, gently mixed for 20-30 min and centrifuged at 7000 rpm for 5 min at 4oC. The aqueous phase was transferred to new tubes and repeat CIA extraction. After the second CIA wash, the DNA was precipitated by adding 300 µl isopropanol, tubes were gently mixed and incubated at room temperature for 30 min. Tubes were centrifuged at 12000 rpm for 10 min and supernatant was decanted. The DNA pellet was dissolved in 50 µl of ddH2O.

• DNA Hybirdization:

DNA hybridization was the first DNA-based technique proposed for the molecular discrimination of Eimeria parasites (Shirley, 1994b)  A typical protocol consisted of genomic DNA digestion with different restriction enzymes, separation through agarose gel electrophoresis, blotting and hybridization with DNA probes composed of repetitive regions. The final result was a DNA fingerprinting comprising multiple band profiles. Similarly to enzyme variation detection, this approach also required large numbers of parasites and was highly time demanding. Also, the method was inherently unable to deal with mixed samples, since overlapping band profiles are not informative.

During DNA hybridization the hydrogen bonds of the target DNA are disrupted by incubating at 95°C or exposure to an alkaline pH. This leads to the formation of ssDNA. The target ssDNA is incubated with the probe at approximately 65°C or below for a prolonged period. If the target DNA sequence is complementary to the probe sequence then hybridization will occur by the formation of hydrogen bonds. The greater the complementarity, the greater the stability of the bonds formed between the target and the probe. Radioactive probes may be detected by autoradiography—an X-ray image indicating the pattern of decay produced by beta or gamma particles. The detection of nonradioactive probes such as biotin is based on their reaction with a specific antibody. The chosen antibody is paired with a chromogenic substance or chemiluminescent substrate. Common chromogenic substances such as NBT (nitro-blue tetrazolium chloride) or BCIP (5-bromo-4-chloro-3′-indolyphosphate p-toluidine salt) yield an intense purple spot on the membrane in the presence of the target DNA (Fig. 28.4). Chemiluminescent substances emit light, which produces etching on photographic film.

• Direct tissue Blot Immunoassay:

Direct tissue blot immunoassay for detection of Xylella fastidiosa in olive trees

A direct tissue blot immunoassay (DTBIA) technique has been compared with ELISA and PCR for detection of Xylella fastidiosa in olive trees from Apulia (southern Italy). Fresh cross-sections of young twigs and leaf petioles were printed onto nitrocellulose membranes and analyzed in the laboratory. Analyses of a first group of 61 samples gave similar efficiency for the three diagnostic techniques for detection the bacterium (24 positive and 36 negative samples), except for a single sample which was positive only with DTBIA and PCR. Similar results were obtained by separately analyzing suckers and twigs collected from different sectors of tree canopies of a second group of 20 olive trees.

Xylella fastidiosa, a gamma proteobacterium in the family Xanthomonadaceae, is a regulated quarantine pest, whose introduction and spread into EU Member States is banned. Four subspecies of the bacterium have been described: ssp. fastidiosa, ssp. pauca, ssp. multiplex and ssp. sandyi (Schaad et al., 2004; Schuenzel et al., 2005). These organisms induce various symptoms (marginal leaf scorching, wilting of foliage and withering of branches, dieback and stunting with eventual plant death) in susceptible host plants. Xytella fastidiosa is transmitted by xylem fluid feeding insect vectors (e.g. Auchenorrhyncha, mainly sharpshooter leafhoppers and froghoppers

or spittlebugs) and is associated with a number of important diseases in a wide range of plant species. However, many host plants may remain latently infected, not showing any symptoms and serving as sources of inoculum for vectors (Hopkins and Purcell, 2002).

Materials and methods

The experimental work was conducted from November 2013 to March 2014, and subdivided in three different steps. In a preliminary step, a total of ten olive trees, five Xf-infected and five Xf-negative as previously identified by ELISA and PCR assays (Loconsole et al., 2014), were used respectively as positive and negative controls for the assessing the DTBIA technique for detection of X. fastidiosa in olive.

In the second step, DTBIA performance was evaluated in comparison with ELISA and PCR using 61 samples from 20 symptomatic olive trees (showing quick decline and leaf scorch: Figure 1) and 41 symptomless trees. Sampled trees were from four commercial orchards located in Gallipoli (2), Parabita and Taviano municipalities (Salento peninsula), largely infected by X. fastidiosa. In symptomatic trees, samples were preferentially collected from symptomatic branches.

In the third step, to investigate distribution of the pathogen in tree canopies, 20 out of the previous 61 tested olive trees were selected as follows: ten symptomatic (all positive) and ten symptomless trees (five positive and five negative). From each tree, five samples, one from basal suckers and one from each of the four branches at different positions in the canopy, were separately collected. A total of 100 samples were then analyzed.

During field operations, samples were stored in closed plastic bags in a cooling box during the delivery to the laboratory. Each sample was divided into three subsamples for comparative assays with ELISA and PCR diagnostic methods.

Dot blot immunoassay (DTBIA)

Tissue blots were prepared as described by Lin et al. (1990). Because X. fastidiosa is localized in host xylem tissues, blots were made from cross sections of mature leaf petioles and twigs (2–5 mm in diameter), apical shoots excluded. Smooth fresh cuts were made with pruning shears, previously disinfected in a 10% solution of chlorine commercial bleach, and cut sections were gently pressed to the membrane (Figure 2). Each type of sample was printed twice. Gloves were used when handling the membranes and in the blotting process.

Two types of Protran (Sigma-Aldrich) nitrocellulose membranes were used, of 0.20 and 0.45 μm pore size, with high affinity for binding proteins and compatibility with a variety of detection methods. The selected membranes were cut to an appropriate size for the number of samples to be blotted, and premarked with a grid of suitable size so as to record the positions of individual samples. The same samples were blotted on both membranes that were processed at two intervals of time, within a few hours of collection and after 1 week.

Printed membranes were left to dry for 20–30 min at room temperature for fresh use or were stored in the dark always at room temperature. They were placed in the blocking solution using different incubation times and concentrations of Bovine Serum Albumin (BSA) or Fat milk solutions. After saturation of protein-binding sites with the selected solution on a shaker and washing with PBS containing 0.05% Tween 20, blotted membranes were exposed for 2 h to alkaline phosphatase-conjugated polyclonal antibodies to X. fastidiosa (Loewe Biochemica GmbH), at different dilutions of conjugate buffer (from 1:50 to 1: 200).

Membranes were then stained by immersion in a solution obtained by dissolving one tablet of Sigma Fast TM BCIP-NBT, in 10 mL of distilled water, and incubation at room temperature until a purple-violet colour appeared in the positive controls. The reaction was stopped by washing with tap water. After drying at room temperature, the membranes were observed under a low power magnification lens (×10 or ×20).