DNA
Assignment
- The genetic materials are formed by chemical building blocks called nucleotides.
- Nucleotides are connected containing phosphate and sugar groups that are alternate to each other. Cells are divided into multiple cellular cells; Development is of many different cells is organized into tissues and organs.
- It refers to two molecules that are side by side, but the molecules run in the opposite direction.
- 5’- Carbon and 3’- Carbon
- Semiconservative replication refers to the process in which the DNA is replicated in all the cells. The process produces two copies that contain the new strand and the original strand.
- DNA synthesis requires a primer made of RNA. A primase synthesizes the ribonucleotide primer ranging from 4 to 12 nucleotides long.
- Prokaryotic cells have one single circular chromosome found in the nucleoid; hence they haploid cells. Eukaryotic cells have DNA organized in multiple lines of chromosomes found in the nucleus known as diploid cells.
- This Will increase the linkage between genes; this is because the linkage between genes leads to the evolution of many different classes of DNA prokaryotic.
-A nucleosome is the basic structural unit of DNA packaging in eukaryotes. The structure of a nucleosome consists of a segment of DNA around eight histone proteins.
- Home-keeping genes include; Actin beta, Ribosomal protein, Glyceraldehyde-3-phosphate
Dehydrogenase, Peptidyl prolyl isomerase A and Glucuronidase, beta. - Lactose enables the transcription of the genes in lac operon; Lactose turns of the repressors.
- The expression of the lac operon is affected since repressors bind the operate site, making RNA unable to bind transcription of the lac genes cannot happen.
- Sugars found in DNA and RNA include; Ribose and Deoxyribose, Nitrogenous found in DNA and RNA include; deminecytosine, guanine, and
- The gene is copied to make a pre-mRNA, namely the exons and introns.
- This would be an inferior codon because the codons are supposed to stop signal during protein synthesis, and when 42 are terminated, it leads to non-correspondence with amino acids.
- Change in gene mutation can lead to malfunction on protein. This can affect normal development since proteins are essential in body functioning.
- The amino acid isoleucine will not be translated, whereas there would be an increase for threonine produced.
- Deletion most damaging while substitutions are the least damaging
- Hydrogen bonds A=T-2 6*2=12
G=C-3 3*3=9 total 12+9= 21 hydrogen bonds
- Met Ala Glu Gly Lys Arg Arg
AUG GCU GAA GGU AAA CGU CGC
AUGGCUGAAGGUAAACGUCGC
TGCCGGCTTCCGTTTGCGGCG