This essay has been submitted by a student. This is not an example of the work written by professional essay writers.
Aging

DNA

Pssst… we can write an original essay just for you.

Any subject. Any type of essay. We’ll even meet a 3-hour deadline.

GET YOUR PRICE

writers online

DNA

Assignment

  • The genetic materials are formed by chemical building blocks called nucleotides.
  • Nucleotides are connected containing phosphate and sugar groups that are alternate to each other. Cells are divided into multiple cellular cells; Development is of many different cells is organized into tissues and organs.
  • It refers to two molecules that are side by side, but the molecules run in the opposite direction.
  • 5’- Carbon and 3’- Carbon
  • Semiconservative replication refers to the process in which the DNA is replicated in all the cells. The process produces two copies that contain the new strand and the original strand.
  • DNA synthesis requires a primer made of RNA. A primase synthesizes the ribonucleotide primer ranging from 4 to 12 nucleotides long.
  • Prokaryotic cells have one single circular chromosome found in the nucleoid; hence they haploid cells.  Eukaryotic cells have DNA organized in multiple lines of chromosomes found in the nucleus known as diploid cells.
  • This Will increase the linkage between genes; this is because the linkage between genes leads to the evolution of many different classes of DNA prokaryotic.

-A nucleosome is the basic structural unit of DNA packaging in eukaryotes. The structure of a nucleosome consists of a segment of DNA around eight histone proteins.

  • Home-keeping genes include; Actin beta, Ribosomal protein, Glyceraldehyde-3-phosphate
    Dehydrogenase, Peptidyl prolyl isomerase A and Glucuronidase, beta.
  • Lactose enables the transcription of the genes in lac operon; Lactose turns of the repressors.
  • The expression of the lac operon is affected since repressors bind the operate site, making RNA unable to bind transcription of the lac genes cannot happen.
  • Sugars found in DNA and RNA include; Ribose and Deoxyribose, Nitrogenous found in DNA and RNA include; deminecytosine, guanine, and
  • The gene is copied to make a pre-mRNA, namely the exons and introns.
  • This would be an inferior codon because the codons are supposed to stop signal during protein synthesis, and when 42 are terminated, it leads to non-correspondence with amino acids.
  • Change in gene mutation can lead to malfunction on protein. This can affect normal development since proteins are essential in body functioning.
  • The amino acid isoleucine will not be translated, whereas there would be an increase for threonine produced.
  • Deletion most damaging while substitutions are the least damaging
  • Hydrogen bonds A=T-2 6*2=12

G=C-3             3*3=9 total 12+9= 21 hydrogen bonds

  • Met Ala    Glu   Gly    Lys     Arg   Arg

AUG GCU GAA GGU AAA CGU CGC

AUGGCUGAAGGUAAACGUCGC

TGCCGGCTTCCGTTTGCGGCG

 

  Remember! This is just a sample.

Save time and get your custom paper from our expert writers

 Get started in just 3 minutes
 Sit back relax and leave the writing to us
 Sources and citations are provided
 100% Plagiarism free
error: Content is protected !!
×
Hi, my name is Jenn 👋

In case you can’t find a sample example, our professional writers are ready to help you with writing your own paper. All you need to do is fill out a short form and submit an order

Check Out the Form
Need Help?
Dont be shy to ask